Hi Galaxy community,
I have a problem when running the alignment with RNA STAR. For me, it’s not clear what the error is.
the error info looks like this:
Oct 21 14:00:44 … started STAR run
Oct 21 14:00:46 … loading genome
Oct 21 14:17:51 … processing annotations GTF
Oct 21 14:18:18 … inserting junctions into the genome indices
Oct 21 14:22:34 … started 1st pass mapping
EXITING because
And when I open BAM file it looks like this:
My data set was trimmed with Cutadapt. Since it was prepared with Illumina TruSeq Kits Single Index. I used the following sequence to trim the adapter:
Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
like suggested by Illumina page (TruSeq Single Indexes )
Is it the trimming that giving the issue? Because I did test run previously without trimming, it went well. But only mapped 68%.
I highly appreciate your help here.
Best,
Azizah