# "This is a new dataset and not all of its data are available yet" for 4 hours with trimmomatic **URL:** \ **Category:** Uncategorized\ **Tags:** troubleshooting, queued-gray-datasets, fastqsanger, exceeds-memory-error, quality-control\ **Created:** [May 21, 2020, 5:06pm UTC](https://help.galaxyproject.org/t/this-is-a-new-dataset-and-not-all-of-its-data-are-available-yet-for-4-hours-with-trimmomatic/3754 "2020-05-21T17:06:41Z")\ **Posts on this page:** 7\ **Page:** 1
**Author:** ![Jack\_Cummins](https://sea2.discourse-cdn.com/flex020/user_avatar/help.galaxyproject.org/jack_cummins/32/1557_2.png) [@Jack\_Cummins](https://help.galaxyproject.org/u/Jack_Cummins)\ **Post date:** [May 21, 2020, 5:06pm UTC](https://help.galaxyproject.org/t/this-is-a-new-dataset-and-not-all-of-its-data-are-available-yet-for-4-hours-with-trimmomatic/3754/1 "2020-05-21T17:06:41Z")
I have been waiting for Trimmomatic to run for 5 hours, but it still says, “This is a new dataset, and not all of its data are available yet.” How can I fix this problem? Should I keep waiting, or take another course of action? Thanks, Jack ---
**Author:** ![vijay](https://sea2.discourse-cdn.com/flex020/user_avatar/help.galaxyproject.org/vijay/32/1001_2.png) [@vijay](https://help.galaxyproject.org/u/vijay)\ **Post date:** [July 2, 2020, 4:21pm UTC](https://help.galaxyproject.org/t/this-is-a-new-dataset-and-not-all-of-its-data-are-available-yet-for-4-hours-with-trimmomatic/3754/2 "2020-07-02T16:21:54Z")
Hi, I have problem running trimmomatic. First i concatenated forward files to one and reverse into other. After this i have run Fastqc for the quality which shows the format sanger/illumina 1.9. After running Trimmomatic tool I got red error msg as below. Please guide me. Thank you Vijay Arguments: - -mx8G - -jar - /mnt/galaxy/tools/trimmomatic/0.32/pjbriggs/trimmomatic/f8a9a5eaca8a/trimmomatic-0.32.jar - PE - -threads - 4 - -phred33 - /mnt/galaxy/files/000/dataset\_84.dat - /mnt/galaxy/files/000/dataset\_83.dat - /mnt/galaxy/files/000/dat ---
**Author:** ![jennaj](https://sea2.discourse-cdn.com/flex020/user_avatar/help.galaxyproject.org/jennaj/32/27_2.png) [@jennaj](https://help.galaxyproject.org/u/jennaj)\ **Post date:** [July 2, 2020, 9:57pm UTC](https://help.galaxyproject.org/t/this-is-a-new-dataset-and-not-all-of-its-data-are-available-yet-for-4-hours-with-trimmomatic/3754/3 "2020-07-02T21:57:28Z")
Hi @vijay More information is needed to troubleshoot the error. This recent Q&A covers the minimum we need to know. `Trimmomatic` also does not have any known server-side issue at this time at any usegalaxy.\* server. But – it looks like you may be working at your own Galaxy server. If so, maybe see if you can reproduce the problem at a public Galaxy server? [BWA-MEM not working](https://help.galaxyproject.org/t/bwa-mem-not-working/4022/2). You might be able to find out what is wrong and fix it by reviewing the bug message itself or the `stderr` or `stdout` on the Job details report (“i” icon in an expanded dataset). You can post back anything you don’t understand and we can try to help more. And hello @Jack_Cummins Longer job queue times are expected across public Galaxy servers. Much prior Q&A covers this along with FAQs, etc. I’ve added tags to this post that cover both situations. Thanks! ---
**Author:** ![vijay](https://sea2.discourse-cdn.com/flex020/user_avatar/help.galaxyproject.org/vijay/32/1001_2.png) [@vijay](https://help.galaxyproject.org/u/vijay)\ **Post date:** [July 4, 2020, 4:11pm UTC](https://help.galaxyproject.org/t/this-is-a-new-dataset-and-not-all-of-its-data-are-available-yet-for-4-hours-with-trimmomatic/3754/4 "2020-07-04T16:11:45Z")
HI, Thank you for the reply. Sorry, i should have mentioned previously that I am using AWS for the Galaxy. I run the Trimmomatic tool again it gave me the same error. Below is the stdout and stderr msg i got. Thank you Vijay **Stderr msg** Fatal error: Exit code 1 () Trimmomatic did not finish successfully **stdout msg** is below Arguments: - -mx8G - -jar - /mnt/galaxy/tools/trimmomatic/0.32/pjbriggs/trimmomatic/f8a9a5eaca8a/trimmomatic-0.32.jar - PE - -threads - 4 - -phred33 - /mnt/galaxy/files/000/dataset\_40.dat - /mnt/galaxy/files/000/dataset\_38.dat - /mnt/galaxy/files/000/dataset\_138.dat - /mnt/galaxy/files/000/dataset\_140.dat - /mnt/galaxy/files/000/dataset\_139.dat - /mnt/galaxy/files/000/dataset\_141.dat - ILLUMINACLIP:/mnt/galaxy/tools/trimmomatic/0.32/pjbriggs/trimmomatic/f8a9a5eaca8a/adapters/NexteraPE-PE.fa:2:30:10 - LEADING:3 - TRAILING:3 TrimmomaticPE: Started with arguments: -threads 4 -phred33 /mnt/galaxy/files/000/dataset\_40.dat /mnt/galaxy/files/000/dataset\_38.dat /mnt/galaxy/files/000/dataset\_138.dat /mnt/galaxy/files/000/dataset\_140.dat /mnt/galaxy/files/000/dataset\_139.dat /mnt/galaxy/files/000/dataset\_141.dat ILLUMINACLIP:/mnt/galaxy/tools/trimmomatic/0.32/pjbriggs/trimmomatic/f8a9a5eaca8a/adapters/NexteraPE-PE.fa:2:30:10 LEADING:3 TRAILING:3 Using PrefixPair: ‘AGATGTGTATAAGAGACAG’ and ‘AGATGTGTATAAGAGACAG’ Using Long Clipping Sequence: ‘GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG’ Using Long Clipping Sequence: ‘TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG’ Using Long Clipping Sequence: ‘CTGTCTCTTATACACATCTCCGAGCCCACGAGAC’ Using Long Clipping Sequence: ‘CTGTCTCTTATACACATCTGACGCTGCCGACGA’ ILLUMINACLIP: Using 1 prefix pairs, 4 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences Java HotSpot™ 64-Bit Server VM warning: INFO: os::commit\_memory(0x0000000788e80000, 924319744, 0) failed; error=‘Cannot allocate memory’ (errno=12) # # There is insufficient memory for the Java Runtime Environment to continue. # Native memory allocation (mmap) failed to map 924319744 bytes for committing reserved memory. # An error report file with more information is saved as: # /mnt/galaxy/tmp/job\_working\_directory/000/99/working/hs\_err\_pid25056.log Exit status: 0 ---
**Author:** ![jennaj](https://sea2.discourse-cdn.com/flex020/user_avatar/help.galaxyproject.org/jennaj/32/27_2.png) [@jennaj](https://help.galaxyproject.org/u/jennaj)\ **Post date:** [July 6, 2020, 1:45pm UTC](https://help.galaxyproject.org/t/this-is-a-new-dataset-and-not-all-of-its-data-are-available-yet-for-4-hours-with-trimmomatic/3754/5 "2020-07-06T13:45:49Z")
Hi @vijay I see a few issues: 1. The error states the job does not have enough memory to process. You probably need to start up a cloud Galaxy on a high-memory default server. 2. The version of the `Trimmomatic` wrapper is outdated. It is the version included in the older Cloudman release, and it was specifically problematic in the past. You can always update tools in your own Galaxy server but that won’t be enough for this situation – the updated tool version will not run well (or at all) in the older Cloudman appliance, plus your configuration choices do not have enough memory allocated. **What to do:** Use the GVL version of the Galaxy cloud appliance and choose a larger high-memory server type. It is based on a more recent Galaxy release (20.01), has pre-installed updated tools, and runs more reliably overall. [https://launch.usegalaxy.org/catalog](https://launch.usegalaxy.org/catalog) Thanks! ---
**Author:** ![vijay](https://sea2.discourse-cdn.com/flex020/user_avatar/help.galaxyproject.org/vijay/32/1001_2.png) [@vijay](https://help.galaxyproject.org/u/vijay)\ **Post date:** [July 6, 2020, 2:57pm UTC](https://help.galaxyproject.org/t/this-is-a-new-dataset-and-not-all-of-its-data-are-available-yet-for-4-hours-with-trimmomatic/3754/6 "2020-07-06T14:57:16Z")
HI, Thank you for the reply. I will use higher memory. Will Trimmomatic tool work fine if i increase memory with older Cloudman. If it doesn’t work can you please suggest me other option to run trimmomatic tool. Thank you Vijay ---
**Author:** ![vijay](https://sea2.discourse-cdn.com/flex020/user_avatar/help.galaxyproject.org/vijay/32/1001_2.png) [@vijay](https://help.galaxyproject.org/u/vijay)\ **Post date:** [July 6, 2020, 4:43pm UTC](https://help.galaxyproject.org/t/this-is-a-new-dataset-and-not-all-of-its-data-are-available-yet-for-4-hours-with-trimmomatic/3754/7 "2020-07-06T16:43:40Z")
HI, Sorry i missed some parts of your email. My question is if i use use GVL version of the galaxy cloud appliance do i need to to restart everything from the scratch or can i start from where i stopped. I have very huge files which i already uploaded on to Galaxy server. Can you please suggest me. Thank you Vijay