Paired-End RNA Seq Trimming Workflow

usegalaxy.eu support
,
1

Hello Galaxy Community,

I am trying to educate myself on this NGS thing. Have some questions regarding my data, paired-end RNA seq. So I have mouse tissue, from Knockout and Control animal, 4 biological replicates for each. They were prepared using TruSeq Kits Single Index. I read on the Illumina page (TruSeq Single Indexes ) that for trimming, I only need these following sequence:

Read 1
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Read 2
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Questions:

  1. Should I use those 2 sequences for all my data sets?
  2. Or do I need only to trim the index sequence, like 6 bp? I know the index sequence for each sample. But it seems inconvenience if I do trimming for all my datasets at once…
  3. The aim of my sequencing is to know the differential gene expression from knockout vs. control as well as to identify splice variants. Is trimming still necessary? Because I read in some discussions for that aim, and if I align it with RNA STAR, trimming is not necessary anymore.

I highly appreciate your help :hugs:

Cheers!