View Button on Reads

I noticed with the recent update with usegalaxy.org and now usegalaxy.eu, when I click on the view button to visually see a portion of the reads, the format has changed. Very much unreadable at this point.

When I assemble contigs with spades, I get a fasta file with my contigs. I used to be able to copy them by hitting the view button and copying whatever number of contigs, and paste them into NCBI Blast. This no longer works. I can individually copy an individual contig into NCBI Blast, but not multiples

Hi @Jon_Colman

Is this the Preview (the raw file) for the fasta? This is the first chunk of data, then the remainder can be downloaded or the dataset URL captured. If you set your history to a shared state, this URL can be used at 3rd party websites or applications.

However, you are current that the web based NCBI BLAST will not accept a URL, so if you want more of the file, downloading is what to try next.

This is what I am seeing with an example. My guess is that your data is larger than the current preview limit of the first ~100 Kb of the file?

These preview limits are set for performance reasons and can be different between servers. UseGalaxy.org and UseGalaxy.eu are now using 100 Kb. UseGalaxy.org.au is still using 1 Mb but might change this too!

Thank you for the feedback about the updated setting. I’ll bring this to the attention of our developers to see what they think! :slight_smile:

I will try again and see if things changed. On the spades contigs, it looked like it wasn’t setting headers for each contig on a separate line. So if I tried to copy more than one contig (which worked fine before), that the header was mixed between different contigs on the same line.

It was basically the same issue if I clicked on the preview of one of my files (say the forward reads for example). Previously each read would start on it’s own new line, but then recently they just combined, so I would have information for 2 different reads on the same line. Seemed to work fine, but visually it wasn’t useable.

I just looked on usegalaxy.org, it looks better now other than it looks like the format and order changed a little.

OK, glad this seems to copy/paste correctly now. I was able to “select all → copy → paste” into a text file and all of the new lines were Ok. The warning messaged needed to be removed at the top but the different fasta files all had the formatting preserved. I tested with the same SPADes output as in my other screenshot and with a few other fasta files I had around.

If you run into a format issue later on, please share here so I can try to reproduce!

Spades contigs still with problems with format. I believe this is what the contig should look like, but what’s happening is that instead of a separate header on it’s own line, the header is in the same line as the start of the contig. So it’s not functioning to be able to copy a contig or multiples and paste them to online BLAST

>NODE_1_length_521_cov_7.695279 ATGAAAAGATCAAATGATGAAATGAAGAAATGATATGAAATGATGAAATGAAGTTAAATG ATTATATGATGAAATAATGAAATGAAATGATGAAATGATGAATTGATGAAATGAAACGAG ATGAAAAGATGAAATGAAATGAGATGAAATGAAATGATGTGATGAAATGAAATCATGAGA TGAAATGATGAAATGATGAGATGATGTGAAATGATGAAATGAAATGAAATAATGAAATGA CAAAATGCAATGATGAGATGAAATGATGAAATGAAATAATGAAATGAAAGGATGAAATGA TATGAAATGATTAAAGGATGAAATGAAATGAGGAAATGAGGAAATCAAATGATGAAATGA TGAAGTGAAATGATGAAATGAAATGAAAAGATGAAATGATGAAATGACATGAAATGATGA AAAGAAATGAAATGAAGTCAAATGATGAAATGATGAAATGATGAAACTAAACGATGAAAT

I assume the problem is with the line endings or similar. I created an issue to track the fix: difference in dataset preview in 26.0 vs 25.1 · Issue #22395 · galaxyproject/galaxy · GitHub

Here, I’ll share the issue. All I’m doing is copying and pasting to NCBI Blast online. In your image example, you can see the header for the fasta on a single line (ABOVE) the contig which is correct. In my example, the header is within the first line of the contig.

This one is from Metaspades on usegalaxy.org, I haven’t tested it on EU.

https://galaxy-main.usegalaxy.org/u/squidly/h/metaspades

Thanks for sharing the example @Jon_Colman – the issue Martin was able to find and report is the same as yours. It seems that SPADes itself is fine but certain other fasta data is not! The developers will sort out what the differences are and get this corrected. Thanks for all the followup!

Looks like it’s fixed now :slight_smile: