Hello all!
I’m running small RNA seq analysis, and so far, I was able to trim and cut adaptors, filter reads by quality, run QC, multiQC, and miRDeep2 mapper, but I can’t make miRDeep2 quantifier work. It appears to be a size issue, but I have already collapsed the reads and normalized the hsa precursors and mature miRNAs.
Has anyone encountered something similar, or do you know what I might be doing wrong?
Thanks!
Welcome @kerstin.muner
Hopefully we can help!
Would you like to share back your failure example? It is hard to guess what may be going wrong, even for memory failures, since these can be due to some small issue with the file formats too, and especially with this tool since the data inputs are so specific.
Or, if you want to try to troubleshoot yourself more first, try comparing your protocol’s input data to the example in this tutorial. Loading the inputs and running the tutorial’s workflow is one quick way to generate the full example for comparison.
You could also review at some prior Q&A involving the tool here for ideas about what to check. Most are tagged with rbc_mirdeep2 rbc_mirdeep2_mapper rbc_mirdeep2_quantifier . Most of these involved the format of one of the files and cover how those were resolved. The logs are usually informative and provide some clues!
Let’s start there! We’d like to help you to resolve this! 
Hello. I am also having problems with mirdeep2_quantifier. I performed trimming of adaptors (TGGAATTCTCGGGTGCCAAGG); they are not a problem anymore (assessed in Falco + MultiQC). In addition, sequence length is picked at 21bp, which I believe is adequate for miRNA.
mirdeep2_mapper results seem to be ok.
And HTML files are also ok. However, tabular files are all zeros. Could you help me troubleshoot 
?
Hi @Carolini
Thanks for posting back more details! I’m not able to reproduce the missing hits with test data, so the tool is working as expected technically from what I can tell.
There is either a problem with the inputs (reference data choice?) or the parameters (threshold of 21 is too strict?) and these are not gaining reportable hits.
You could try dropping the threshold to see what happens?
