outMultimapperOrder in STAR alignment

Dear Galaxy,
This is the first time I have ever posted anything about bioinformatics. I have been a 100% wet guy in a small lab. I never touched linux… I have no workstation to work on anyway. But with Galaxy, I have been able to appreciate some of the amazing aspect of Big Data mostly chIP-Seq & RNA-Seq. Stuff as simple as generating .bigwig for a peak in IGV can easily make my day. It really opens up a new world.
So for all these joys, I owe to you. I can not say enough ‘Thank you’.
I hit many rocks when self-studying with internet resources. For most of them, I can find an answer. This time I have run into a problem, I believe, can be only solved by your guys.
Source of Problem (I believe): -outMultimapperOrder seems not to be realized in galaxy wrapper for STAR.
Problem: biased alignment with multi-mapping reads
Phenomenon: (A test FastqSanger) + A test genome Fasta: as follows
1READ_1_4M
GGCGGGATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCAT
+
FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF
2READ_2_2M
CCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCA
+
FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF
3READ_3_1M
AGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGG
+
FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF
4READ_4_1M
AGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGG
+
FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF
5READ_5_1M
AGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGG
+
FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF
6READ_6_1M
AGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGG
+
FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF
7READ_7_1M
AGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGG
+
FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF
8READ_8_1M
AGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGG
+
FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF
9READ_9_4M
GGCGGGATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCAT
+
FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF
10READ_10_4M
GGCGGGATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCAT
+
FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF
11READ_11_4M
GGCGGGATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCAT
+
FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF
12READ_12_0M
ATAGTTAGAGGTCTCTAGTGTACCGGTCATGTCCGGTCTGGAGACCCATT
+
FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF
13READ_13r5_4M
GATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGG
+
FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF
14READ_14r10_4M
TGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAG
+
FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF

##fasta file

chr1
GGCGGGATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGG
chr2
GGCGGGATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCG
chr3
GGCGGGATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGGGCGGGATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGGGCGGGATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGGGCGGGATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGGGCGGGATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGGGCGGGATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGGGCGGGATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGG
chr4
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCGGGATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
chr5
GGCGGGATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCAAGCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAG

Result with STAR:
STAR for some reason unknown to me, pick ‘chr5’ as its primary alignment for all the reads.
I changed the order of chr5 to 3rd place, still the same.

1READ_1_4M 256 chr1 1 0 50M * 0 0 GGCGGGATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCAT FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:11 HI:i:11 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
9READ_9_4M 256 chr1 1 0 50M * 0 0 GGCGGGATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCAT FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:11 HI:i:11 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
10READ_10_4M 256 chr1 1 0 50M * 0 0 GGCGGGATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCAT FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:11 HI:i:11 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
11READ_11_4M 256 chr1 1 0 50M * 0 0 GGCGGGATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCAT FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:11 HI:i:11 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
13READ_13r5_4M 256 chr1 6 0 50M * 0 0 GATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGG FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:11 HI:i:11 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
14READ_14r10_4M 256 chr1 11 0 50M * 0 0 TGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAG FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:11 HI:i:11 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
1READ_1_4M 256 chr2 1 0 50M * 0 0 GGCGGGATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCAT FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:11 HI:i:2 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
9READ_9_4M 256 chr2 1 0 50M * 0 0 GGCGGGATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCAT FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:11 HI:i:2 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
10READ_10_4M 256 chr2 1 0 50M * 0 0 GGCGGGATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCAT FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:11 HI:i:2 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
11READ_11_4M 256 chr2 1 0 50M * 0 0 GGCGGGATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCAT FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:11 HI:i:2 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
13READ_13r5_4M 256 chr2 6 0 50M * 0 0 GATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGG FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:11 HI:i:2 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
14READ_14r10_4M 256 chr2 11 0 50M * 0 0 TGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAG FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:11 HI:i:2 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
2READ_2_2M 256 chr2 81 3 50M * 0 0 CCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCA FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:2 HI:i:2 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
1READ_1_4M 256 chr3 1 0 50M * 0 0 GGCGGGATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCAT FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:11 HI:i:3 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
9READ_9_4M 256 chr3 1 0 50M * 0 0 GGCGGGATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCAT FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:11 HI:i:3 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
10READ_10_4M 256 chr3 1 0 50M * 0 0 GGCGGGATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCAT FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:11 HI:i:3 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
11READ_11_4M 256 chr3 1 0 50M * 0 0 GGCGGGATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCAT FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:11 HI:i:3 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
13READ_13r5_4M 256 chr3 6 0 50M * 0 0 GATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGG FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:11 HI:i:3 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
14READ_14r10_4M 256 chr3 11 0 50M * 0 0 TGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAG FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:11 HI:i:3 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
1READ_1_4M 256 chr3 81 0 50M * 0 0 GGCGGGATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCAT FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:11 HI:i:4 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
9READ_9_4M 256 chr3 81 0 50M * 0 0 GGCGGGATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCAT FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:11 HI:i:4 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
10READ_10_4M 256 chr3 81 0 50M * 0 0 GGCGGGATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCAT FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:11 HI:i:4 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
11READ_11_4M 256 chr3 81 0 50M * 0 0 GGCGGGATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCAT FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:11 HI:i:4 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
13READ_13r5_4M 256 chr3 86 0 50M * 0 0 GATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGG FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:11 HI:i:4 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
14READ_14r10_4M 256 chr3 91 0 50M * 0 0 TGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAG FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:11 HI:i:4 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
1READ_1_4M 256 chr3 161 0 50M * 0 0 GGCGGGATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCAT FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:11 HI:i:5 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
9READ_9_4M 256 chr3 161 0 50M * 0 0 GGCGGGATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCAT FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:11 HI:i:5 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
10READ_10_4M 256 chr3 161 0 50M * 0 0 GGCGGGATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCAT FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:11 HI:i:5 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
11READ_11_4M 256 chr3 161 0 50M * 0 0 GGCGGGATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCAT FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:11 HI:i:5 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
13READ_13r5_4M 256 chr3 166 0 50M * 0 0 GATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGG FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:11 HI:i:5 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
14READ_14r10_4M 256 chr3 171 0 50M * 0 0 TGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAG FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:11 HI:i:5 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
1READ_1_4M 256 chr3 241 0 50M * 0 0 GGCGGGATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCAT FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:11 HI:i:6 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
9READ_9_4M 256 chr3 241 0 50M * 0 0 GGCGGGATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCAT FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:11 HI:i:6 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
10READ_10_4M 256 chr3 241 0 50M * 0 0 GGCGGGATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCAT FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:11 HI:i:6 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
11READ_11_4M 256 chr3 241 0 50M * 0 0 GGCGGGATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCAT FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:11 HI:i:6 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
13READ_13r5_4M 256 chr3 246 0 50M * 0 0 GATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGG FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:11 HI:i:6 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
14READ_14r10_4M 256 chr3 251 0 50M * 0 0 TGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAG FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:11 HI:i:6 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
1READ_1_4M 256 chr3 321 0 50M * 0 0 GGCGGGATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCAT FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:11 HI:i:7 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
9READ_9_4M 256 chr3 321 0 50M * 0 0 GGCGGGATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCAT FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:11 HI:i:7 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
10READ_10_4M 256 chr3 321 0 50M * 0 0 GGCGGGATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCAT FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:11 HI:i:7 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
11READ_11_4M 256 chr3 321 0 50M * 0 0 GGCGGGATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCAT FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:11 HI:i:7 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
13READ_13r5_4M 256 chr3 326 0 50M * 0 0 GATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGG FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:11 HI:i:7 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
14READ_14r10_4M 256 chr3 331 0 50M * 0 0 TGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAG FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:11 HI:i:7 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
1READ_1_4M 256 chr3 401 0 50M * 0 0 GGCGGGATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCAT FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:11 HI:i:8 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
9READ_9_4M 256 chr3 401 0 50M * 0 0 GGCGGGATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCAT FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:11 HI:i:8 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
10READ_10_4M 256 chr3 401 0 50M * 0 0 GGCGGGATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCAT FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:11 HI:i:8 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
11READ_11_4M 256 chr3 401 0 50M * 0 0 GGCGGGATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCAT FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:11 HI:i:8 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
13READ_13r5_4M 256 chr3 406 0 50M * 0 0 GATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGG FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:11 HI:i:8 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
14READ_14r10_4M 256 chr3 411 0 50M * 0 0 TGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAG FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:11 HI:i:8 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
1READ_1_4M 256 chr3 481 0 50M * 0 0 GGCGGGATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCAT FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:11 HI:i:9 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
9READ_9_4M 256 chr3 481 0 50M * 0 0 GGCGGGATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCAT FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:11 HI:i:9 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
10READ_10_4M 256 chr3 481 0 50M * 0 0 GGCGGGATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCAT FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:11 HI:i:9 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
11READ_11_4M 256 chr3 481 0 50M * 0 0 GGCGGGATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCAT FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:11 HI:i:9 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
13READ_13r5_4M 256 chr3 486 0 50M * 0 0 GATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGG FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:11 HI:i:9 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
14READ_14r10_4M 256 chr3 491 0 50M * 0 0 TGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAG FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:11 HI:i:9 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
1READ_1_4M 256 chr4 51 0 50M * 0 0 GGCGGGATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCAT FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:11 HI:i:10 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
9READ_9_4M 256 chr4 51 0 50M * 0 0 GGCGGGATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCAT FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:11 HI:i:10 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
10READ_10_4M 256 chr4 51 0 50M * 0 0 GGCGGGATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCAT FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:11 HI:i:10 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
11READ_11_4M 256 chr4 51 0 50M * 0 0 GGCGGGATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCAT FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:11 HI:i:10 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
13READ_13r5_4M 256 chr4 56 0 50M * 0 0 GATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGG FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:11 HI:i:10 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
14READ_14r10_4M 256 chr4 61 0 50M * 0 0 TGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAG FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:11 HI:i:10 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
1READ_1_4M 0 chr5 1 0 50M * 0 0 GGCGGGATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCAT FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:11 HI:i:1 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
9READ_9_4M 0 chr5 1 0 50M * 0 0 GGCGGGATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCAT FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:11 HI:i:1 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
10READ_10_4M 0 chr5 1 0 50M * 0 0 GGCGGGATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCAT FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:11 HI:i:1 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
11READ_11_4M 0 chr5 1 0 50M * 0 0 GGCGGGATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCAT FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:11 HI:i:1 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
13READ_13r5_4M 0 chr5 6 0 50M * 0 0 GATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGG FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:11 HI:i:1 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
14READ_14r10_4M 0 chr5 11 0 50M * 0 0 TGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAG FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:11 HI:i:1 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
2READ_2_2M 0 chr5 81 3 50M * 0 0 CCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCA FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:2 HI:i:1 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
3READ_3_1M 0 chr5 131 60 50M * 0 0 AGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGG FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:1 HI:i:1 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
4READ_4_1M 0 chr5 131 60 50M * 0 0 AGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGG FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:1 HI:i:1 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
5READ_5_1M 0 chr5 131 60 50M * 0 0 AGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGG FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:1 HI:i:1 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
6READ_6_1M 0 chr5 131 60 50M * 0 0 AGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGG FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:1 HI:i:1 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
7READ_7_1M 0 chr5 131 60 50M * 0 0 AGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGG FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:1 HI:i:1 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
8READ_8_1M 0 chr5 131 60 50M * 0 0 AGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGG FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF NH:i:1 HI:i:1 AS:i:49 nM:i:0 NM:i:0 MD:Z:50 jM:B:c,-1 jI:B:i,-1
12READ_12_0M 4 * 0 0 * * 0 0 ATAGTTAGAGGTCTCTAGTGTACCGGTCATGTCCGGTCTGGAGACCCATT

If I force the output to one alignment each read, then only the above “primary alignments” will be output.

I looked at STAR manual and Bowtie2 manual. I believe the above phenomenon is related to ‘random vs deterministic’ .

I tried similar stuff with Bowtie2 on galaxy. Bowtie2 picks different chromosome as primary alignment for different reads even without the “–not deterministic” option.(which is different from STAR result shown here)

As you can see, in genome, we have gene families, pseudogenes, and transposons with thousands of copies. The behavior of STAR galaxy wrapper as shown above will cause dramatic bias. I want to actually use the STAR “-outMultimapperOrder random” for Transposon transcription analysis etc…for my projects (I understand. for RNA-Seq, including -M / fraction in featureCounts could be another bypass, but Random is still preferred based on my reading). Plus I also need to perform ChIP-seq analysis with transposons. I don’t know a way featureCounts can facilitate the Peakcalling process. So seems Random is the answer to all my problems. Correct me if I am wrong.

I have one question and one request.
Question: how does STAR decide which read to pick as primary alignment by default? (Eg, bowtie2 claims this is function of the read name+read sequence+read quality + seed). Does star not use read name to decide the primary (all reads are picking the same chromosome as primary hit)?

If what I describe above is true. Will it be possible galaxy can kindly add the “-outMultimapperOrder” Random option, PLEASE ?

@ jennaj

Sorry, I don’t exactly know how this “galaxy help” works. Jen, I saw your responses to questions at Biostar…
I see no response, I apologize if I am disturbing you.