Unexpected result from tool Fastq Splitter

Hello when i use fastq spliter to separate the forward and reverse strand no error but the final result contain no sequence shows 0 byte result

Hi - A bit more information will help to troubleshoot:

1 - What version of the tool are you using? Click on the rerun button and copy the name/version of the tool back in the reply.

2 - Where are you running the tool? If a public server, capture the base URL. If your own Galaxy, what version was installed?

3 - What do the sequences look like? Please copy/paste back in a few complete fastq records (all four lines).

Thanks!

Update: I was able to find your account at the Galaxy Main https://usegalaxy.org public server. No more information is needed.

What to do:

The data is an interleaved/interlaced fastq dataset from NBCI. The tool you want to use instead is the Fastq De-interlacer – this will output two datasets, one representing the forward reads and one representing the reverse reads.

Full details are in the Galaxy support FAQs: https://galaxyproject.org/support/#getting-inputs-right

hello sir paired-end
of my SRA raw data are different in lenght so the fastq splitter and Fastq De-interlacer cannot split it kindly suggest me any tool or any script so that i split my raw sequence and assemble it

** 1-
FASTQ de-interlacer** on
paired end reads (Galaxy Version 1.1.2)

and

** FASTQ
splitter** on
joined paired end reads (Galaxy Version 1.1.1)

on
SRA raw data

2-
i am running on galaxy server in Pakistan

https://usegalaxy.org/?tool_id=toolshed.g2.bx.psu.edu%2Frepos%2Fdevteam%2Ffastq_paired_end_splitter%2Ffastq_paired_end_splitter%2F1.1.1&version=1.1.1&__identifer=f4ze0d9gyhj

3-
my sequence is in raw for i want to split the paired-ends

Kindly
suggest me the tool or any script for this.

Thanks

@1/1
NACATTCCGGATTTATAGTCTTGCTAACAAAATCCACCTCAACGGATGTCTCAGTATTAAACATTTTCCACCCTAATGAATCAATAGTAGAAGACCAATCATTCATATCTCCTCTATGTGGACAATAATAAACTATGCTATTCTTATATTT

Are the complete reads for both ends in the same file again? I cannot tell from your posted example. If so, then the Deinterlacer tool is what you need to use, even if the forward and reverse reads are of different lengths.

Example interlaced fastq dataset that the deinterlacer tool will work on:

@1/1
ATCG
+
!!!!
@1/2
ATCGATCG
+
!!!!!!!!

I am not familiar with any fastq data that comes from SRA where joined (not interlaced) fastq reads would be of different lengths.

What accession is your new data from?