Hi
I have some trouble in downloading paired end datasets.
After founding datasets i want to download them through Download and Extract Reads in FASTA/Q tool. one by one with SRA accession option. But in this case i have just one dataset instead of two for each pair.
AND option of “list of accession numbers” not working for a while.
Kind regards
Is it possible that the files are Interlaced? See:
https://galaxyproject.org/support/ncbi-sra-fastq/
Based of what i saw in the link you sent, i dont think that was my problem
@1/1
GGCGCGGCCCTTCTCGGCGAGGCGGCGGCGGCGCGGAAGCCGTGGTCCGGGCTCTGGCCGCGGCGCCGGGAGCGACAACGGTTGCGAGCCCGGGGCTCGA
+
FFFFFFFFFFFFGFFF=FF@FFEFFFFFFFFFFFFFAFFFFBBFGGFG=FFFEGDFFEFFFBFFFBF@DF/F8FFF@FGFF/FFF9)G7EGBFF<8GEGE
@2/1
CTCTCTCCTCAGCGCTTCTTCTTTCTTGGTTTGATCCTGACTGCTGTCATGGCGTGCCCTCTGGAGAAGGCCCTGGATGTGATGGTGTTCACCTTCCACA
+
;FDF:B5<FCC8E9FBABCBFAF=EE98EFECBFC7FDC=FFBFCF@EFEBD07DFDF:F:?<@==?D4BDA=D?3>=A9BF=;4@&AD7<><;>:ED
@3/1
AGCGGGGGCCCTCAGGGAAGCAACCCAGCTCGCATCTGGAAGGCCAGGCAGTCCCCTCGGGTGGCTTGCTTGTTGATCTCTCTGTGTCGTTCTTTGGTTA
+
AEE0BAD=EDEEEEDECB?C54EF:FDEFDDEFDFDEFD0BCEFCEE7EEFDDCEDF>FEA>F:CDEF=FEEBFEDDFECFCE.EFEEFE0:FECEDF?F
@4/1
this is example of the reads and it is different from what is mentioned about Interlaced reads
My problem is : I found a dataset which is not available in ENA but its available in SRA file. and because it is paired end, I don’t know how i can download it.