Identification of Cre-recombinase in ScRNAseq data

Dear All,

I would like to know, how to identify Cre-recombinase is expressed or not in my scRNAseq data? I have fastq files, Please help to guide in this. Thanks in advance.

Hi @Barani_Rajendran,
you can use RNA STAR for mapping the Cre-recombinase sequence against your dataset. You can examine if the Cre-recombinase mapped to the sequences in the log file generated by that tool.

Hi Thanks for your reply and sorry for very late reply. since I was away from my work.

My question is how to align my cre sequence is something like below. I really new and don’t know how to align with target sequence?
I have RNA-STAR aligned sam file, is it possible to align my cre sequence with Sam file? Please kindly explain. Thanks for your help.

ā€œatgtccaatttactgaccgtacaccaaaatttgcctgcattaccggtcgatgcaacgagtgatgaggttcgcaagaacctgatggacatgttcagggatcgccaggcgttttctgagcatacctggaaaatgcttctgtccgtttgccggtcgtgggcggcatggtgcaagttgaataaccggaaatggtttcccgcagaacctgaagatgttcgcgattatcttctatatcttcaggcgcgcggtctggcagtaaaaactatccagcaacatttgggccagctaaacatgcttcatcgtcggtccgggctgccacgaccaagtgacagcaatgctgtttcactggttatgcggcggatccgaaaagaaaacgttgatgccggtgaacgtgcaaaacaggctctagcgttcgaacgcactgatttcgaccaggttcgttcactcatggaaaatagcgatcgctgccaggatatacgtaatctggcatttctggggattgcttataacaccctgttacgtatagccgaaattgccaggatcagggttaaagatatctcacgtactgacggtgggagaatgttaatccatattggcagaacgaaaacgctggttagcaccgcaggtgtagagaaggcacttagcctgggggtaactaaactggtcgagcgatggatttccgtctctggtgtagctgatgatccgaataactacctgttttgccgggtcagaaaaaatggtgttgccgcgccatctgccaccagccagctatcaactcgcgccctggaagggatttttgaagcaactcatcgattgatttacggcgctaaggatgactctggtcagagatacctggcctggtctggacacagtgcccgtgtcggagccgcgcgagatatggcccgcgctggagtttcaataccggagatcatgcaagctggtggctggaccaatgtaaatattgtcatgaactatatccgtaacctggatagtgaaacaggggcaatggtgcgcctgctggaagatggcgattagā€

Hi @Barani_Rajendran,
in order to map the Cre-recombinase gene against the scRNAseq sequeces, firstly you need to extract the fasta file from the SAM file by using the Samtools fastx tool. The next step is to upload your CRE sequence to Galaxy; I generated the FASTA file from your sequence. Finally you can use RNA-STAR to perform the mapping.

Regards